DNA Bank Top |  KEGG KO K09040 > 

RIKEN DNA Bank Human Resource - NFE2L1

Gene ID NCBI Gene 4779 |  KEGG hsa:4779
Gene Symbol NFE2L1
Protein Name NFE2 like bZIP transcription factor 1
Synonyms LCR-F1|NRF-1|NRF1|TCF11

Link

Ortholog resource in our bank

  NFE2L1


External database

human NFE2L1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07014 pCMFlag_hsNRF1 Expression vector of human NRF1.    
RDB07013 pCMFlag_hsNRF1 Expression vector of human NRF1.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005447 IRAK013K07 pCMV-SPORT6 BC010623 NM_003204 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025827 W01A064J11 pENTR-TOPO IRAK013K07 BC010623 NM_003204  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050951 ARe27G07 pKA1U5 NM_003204.2  
GGCACTTGTTCGCTGGCCGCCCCTGGAGGCTAGAAGCTCCGGCGCCGAGAGTGGGCATGG
HKR277741 ARiS194F21 pGCAP10 NM_003204.2  
GGCTCTAGGCCGGCCGGCGGTGGCGGCGGCGAGGCCGGGACTCGGGCTTAGGGCCTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.25

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl