Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NFE2L1

Gene ID (NCBI) 4779
Gene Symbol NFE2L1
Protein Name nuclear factor, erythroid 2 like 1
Synonyms LCR-F1|NRF1|TCF11
Databases KEGG hsa:4779 |  NCBI Gene 4779
Featured content Ortholog resources in the DNA Bank (KEGG orthology K09040)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07014 pCMFlag_hsNRF1 Expression vector of human NRF1
RDB07013 pCMFlag_hsNRF1 Expression vector of human NRF1

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005447 IRAK013K07 pCMV-SPORT6 BC010623 NM_003204 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025827 W01A064J11 pENTR-TOPO IRAK013K07 BC010623 NM_003204  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050951 ARe27G07 pKA1U5 NM_003204.2  
GGCACTTGTTCGCTGGCCGCCCCTGGAGGCTAGAAGCTCCGGCGCCGAGAGTGGGCATGG
HKR277741 ARiS194F21 pGCAP10 NM_003204.2  
GGCTCTAGGCCGGCCGGCGGTGGCGGCGGCGAGGCCGGGACTCGGGCTTAGGGCCTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl