DNA Bank Top |  KEGG KO K17334 > 

RIKEN DNA Bank Human Resource - NFATC4

Gene ID NCBI Gene 4776 |  KEGG hsa:4776
Gene Symbol NFATC4
Protein Name nuclear factor of activated T cells 4
Synonyms NF-AT3|NF-ATC4|NFAT3
Featured content Wnt signaling pathway (human)
Featured content Axon guidance - human

Link

Ortholog resource in our bank

  NFATC4

External database

human NFATC4

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07376 pGL4-phNFATC4 Promoter collection, Human NFATC4 promoter    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046121 IRAK115F01 pCMV-SPORT6 BC053855 NM_004554 Full
HGY090421 IRAL026A21 pOTB7 BC008857 NM_004554 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203488 ARiS008L24 pGCAP10 NM_004554.4  
AAAAAGTTTCTATAATAACGAGGGGGCTTCTGGAGGGAGGCGGCAGCGACGGAGGAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.01

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl