Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NEUROG1

Gene ID (NCBI) 4762
Gene Symbol NEUROG1
Protein Name neurogenin 1
Synonyms AKA|Math4C|NEUROD3|bHLHa6|ngn1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Signaling pathways regulating pluripotency of stem cells (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005482 IRAK013L18 pCMV-SPORT6 BC008687 NM_006161 Full
HGX025068 IRAK062L04 pCMV-SPORT6 BC028226 NM_006161

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE017249 W01A043C01 pENTR-TOPO IRAK013L18 BC008687 NM_006161
HGE017257 W01A043C09 pENTR-TOPO IRAK013L18 BC008687 NM_006161
HGE017259 W01A043C11 pENTR-TOPO IRAK013L18 BC008687 NM_006161
HGE017261 W01A043C13 pENTR-TOPO IRAK013L18 BC008687 NM_006161
HGE017263 W01A043C15 pENTR-TOPO IRAK013L18 BC008687 NM_006161
HGE017265 W01A043C17 pENTR-TOPO IRAK013L18 BC008687 NM_006161

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR361729 RBd04F09 pGCAP10 NM_006161.2
GACACTCGGTGCTCACACGAGCTGATCTGATCGCCGGCGACATCACTCAGGAGACCGGCC
HKR371209 RBd28A09 pGCAP10 NM_006161.2
GCTTTTCCTCGGTGCTCGCAGAAGGTGATCTGATGGGCGGTTACATCTTCCCGGAGACCG
HKR372449 RBd31C01 pGCAP10 NM_006161.2
GACACACTCGGTGCTCACACGAGCTGATCTGATCGCCGGCGACATCACTCAGGAGACCGG
HKR461828 RBdS154J12 pGCAP10 NM_006161.2
GGCCACACTCGGTGCTCACACGAGCTGATCTGATCGCCGGCGACATCACTCAGGAGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl