Prev. |  KEGG KO K09081 > 

RIKEN DNA Bank Human Resource - NEUROG1

Gene ID NCBI Gene 4762 |  KEGG hsa:4762
Gene Symbol NEUROG1
Protein Name neurogenin 1
Synonyms AKA|Math4C|NEUROD3|bHLHa6|ngn1
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Ortholog resource in our bank

  NEUROG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005482 IRAK013L18 pCMV-SPORT6 BC008687 NM_006161 Full
HGX025068 IRAK062L04 pCMV-SPORT6 BC028226 NM_006161

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017249 W01A043C01 pENTR-TOPO IRAK013L18 BC008687 NM_006161  
HGE017257 W01A043C09 pENTR-TOPO IRAK013L18 BC008687 NM_006161  
HGE017259 W01A043C11 pENTR-TOPO IRAK013L18 BC008687 NM_006161  
HGE017261 W01A043C13 pENTR-TOPO IRAK013L18 BC008687 NM_006161  
HGE017263 W01A043C15 pENTR-TOPO IRAK013L18 BC008687 NM_006161  
HGE017265 W01A043C17 pENTR-TOPO IRAK013L18 BC008687 NM_006161  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR361729 RBd04F09 pGCAP10 NM_006161.3 full cds  
GACACTCGGTGCTCACACGAGCTGATCTGATCGCCGGCGACATCACTCAGGAGACCGGCC
HKR371209 RBd28A09 pGCAP10 NM_006161.2  
GCTTTTCCTCGGTGCTCGCAGAAGGTGATCTGATGGGCGGTTACATCTTCCCGGAGACCG
HKR372449 RBd31C01 pGCAP10 NM_006161.2  
GACACACTCGGTGCTCACACGAGCTGATCTGATCGCCGGCGACATCACTCAGGAGACCGG
HKR461828 RBdS154J12 pGCAP10 NM_006161.2  
GGCCACACTCGGTGCTCACACGAGCTGATCTGATCGCCGGCGACATCACTCAGGAGACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl