Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NEK2

Gene ID (NCBI) 4751
Gene Symbol NEK2
Protein Name NIMA-related kinase 2
Synonyms HsPK21|NEK2A|NLK1|RP67
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX035703 IRAK089E07 pCMV-SPORT6 BC043502 NM_002497 Full
HGX046118 IRAK115E22 pCMV-SPORT6 BC052807 NM_002497 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE047213 W01A118A13 pENTR-TOPO IRAK089E07 BC043502 NM_002497
HGE047215 W01A118A15 pENTR-TOPO IRAK089E07 BC043502 NM_002497
HGE047221 W01A118A21 pENTR-TOPO IRAK089E07 BC043502 NM_002497
HGE047223 W01A118A23 pENTR-TOPO IRAK089E07 BC043502 NM_002497

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR192036 ARi80B12 pGCAP10 NM_002497.2
CGGCCGGCCGATGACGGTTAAACGGGGCCCAAGGCAGGGGTGGCGGGTCAGTGCTGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl