Prev. |  KEGG KO K20872 > 

RIKEN DNA Bank Human Resource - NEK2

Gene ID NCBI Gene 4751 |  KEGG hsa:4751
Gene Symbol NEK2
Protein Name NIMA related kinase 2
Synonyms HsPK21|NEK2A|NLK1|PPP1R111|RP67
Ortholog resource in our bank

  NEK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035703 IRAK089E07 pCMV-SPORT6 BC043502 NM_002497 Full
HGX046118 IRAK115E22 pCMV-SPORT6 BC052807 NM_002497 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE047213 W01A118A13 pENTR-TOPO IRAK089E07 BC043502 NM_002497  
HGE047215 W01A118A15 pENTR-TOPO IRAK089E07 BC043502 NM_002497  
HGE047221 W01A118A21 pENTR-TOPO IRAK089E07 BC043502 NM_002497  
HGE047223 W01A118A23 pENTR-TOPO IRAK089E07 BC043502 NM_002497  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR192036 ARi80B12 pGCAP10 NM_002497.2  
CGGCCGGCCGATGACGGTTAAACGGGGCCCAAGGCAGGGGTGGCGGGTCAGTGCTGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl