Prev. |  KEGG KO K10591 > 

RIKEN DNA Bank Human Resource - NEDD4

Gene ID NCBI Gene 4734 |  KEGG hsa:4734
Gene Symbol NEDD4
Protein Name neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase
Synonyms NEDD4-1|RPF1
Ortholog resources KEGG ortholog (KEGG orthology K10591) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031662 IRAK079C14 pCMV-SPORT6 BC035707 NM_006154 Partial/var
HGX037300 IRAK093E04 pCMV-SPORT6 BC047035 NM_198400 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR375699 RBd39E03 pGCAP10 NM_006154.2  
GGGAAGCGTTCGGAAATGGCAACTTGCGCGGTGGAGGTGTTCGGGCTCCTGGAGGACGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl