Prev. | 

RIKEN DNA Bank Human Resource - DRG1

Gene ID NCBI Gene 4733 |  KEGG hsa:4733
Gene Symbol DRG1
Protein Name developmentally regulated GTP binding protein 1
Synonyms NEDD3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083610 IRAL009A10 pOTB7 BC019285 NM_004147 Full
HGY094113 IRAL035E17 pDNR-LIB BC020803 NM_004147 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001522 W01A003N10 pENTR-TOPO IRAL009A10 BC019285 NM_004147  
HGE001526 W01A003N14 pENTR-TOPO IRAL009A10 BC019285 NM_004147  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061605 ARe54A05 pKA1U5 NM_004147.3  
GAGTTAGCGCCTGGTGGCGGTGGCAGTTTGCCCGCGGGTGTGTGAAGGGAGACAGTGTGG
HKR325283 RBb13D11 pKA1U5 NM_004147.3  
HKR344973 RBb62H05 pGCAP1 NM_004147.3  
GGCAGTTTGCCCGCGGGTGTTGTGAAGGGAGACAGTGTGGAGGCCACAGGGTACTCGCCA
HKR384107 RBd60E11 pGCAP10 NM_004147.3  
GGCCTGGTGGCGGTGGCAGTTTGCCCGCGGGTGTGTGAAGGGAGACAGTGTGGAGGCCAC
HKR444360 RBdS110O24 pGCAP10 NM_004147.3  
GGCCCGCGGGTGTGTGAAGGGAGACAGTGTGGAGGCCACAGGGTACTCGCCACGATGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl