Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFV2

Gene ID (NCBI) 4729
Gene Symbol NDUFV2
Protein Name NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Synonyms CI-24k
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX066468 IRAK166C20 pCMV-SPORT6 BC071689 NM_021074 Full
HGY083327 IRAL008F07 pOTB7 BC001632 NM_021074 Full/var
HGY089446 IRAL023K06 pOTB7 BC017487 NM_021074 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR049649 ARe24C01 pKA1U5 NM_021074.2
GCTTCTTCTCCGCGGCGCTCCGGGCCCGGGCGGCTGGCCTCACCGCCCACTGGGGAAGAC
HKR171729 ARi29F09 pGCAP10 NM_021074.2
GGGGGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCG
HKR183753 ARi59G09 pGCAP10 NM_021074.2
GGGGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCGG
HKR205537 ARiS013O01 pGCAP10 NM_021074.2
GCTCGCCTGGCGCGGCTGGGGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGC
HKR328548 RBb21G04 pKA1U5 NM_021074.2
GCTCGCCTGGCGCGGCTGGGGAAGGTGAACAGCTGTGGCCCGCCATGTTCTTCTCCGCGG
HKR329746 RBb24G02 pGCAP1 NM_021074.2
TGGGGGAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCG
HKR368453 RBd21C05 pGCAP10 NM_021074.2
TGGCCTGGCGCGGCTGGGGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGC
HKR373345 RBd33G01 pGCAP10 NM_021074.2
GGGGGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCG
HKR340923 RBb52F03 pGCAP1 NM_021074.2
TAGTGGCGCGGCTGGGGAAGGTGAACAGTGTGGCCCGCCATGTTTCTTCTCCGCGGCGCT
HKR385328 RBd63F08 pGCAP10 NM_021074.2
GGCGGCGCTCCGGGCCCGGGCGGCTGGCCTCACCGCCCACTGGGGAAGACATGTAAGGAA
HKR416111 RBdS040E15 pGCAP10 NM_021074.2
GGGGGAAGGTGAACAGTGTGGCCCGCCATGTTCTTCTCCGCGGCGCTCCGGGCCCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl