Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFS8

Gene ID (NCBI) 4728
Gene Symbol NDUFS8
Protein Name NADH:ubiquinone oxidoreductase core subunit S8
Synonyms CI-23k|CI23KD|TYKY
Databases KEGG hsa:4728 |  NCBI Gene 4728
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03941)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042553 ARe06G09 pKA1U5 NM_002496.2  
GCCCGATTGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCC
HKR046521 ARe16F01 pKA1U5 NM_002496.2  
GACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGACCACG
HKR075298 ARe88E02 pKA1U5 NM_002496.2  
GAGCCTCCGCCTCCCGATTGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAA
HKR077282 ARe93D10 pKA1U5 NM_002496.2  
GGTAGCCTCCGCCTCCCGATTGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTC
HKR081300 ARf03E04 pKA1U5 NM_002496.2  
GGTAGCCTCCGCCTCCCGATTGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTC
HKR081657 ARf04C09 pKA1U5 NM_002496.2  
GGCCTCCCGATTGACTGGCCTGATTGGGNAGGCNAGTNAAGGCGGCGCTTCAAGATGCGC
HKR175607 ARi39A07 pGCAP10 NM_002496.2  
GGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGACCACGCCTATGCTGCTGC
HKR175651 ARi39C03 pGCAP10 NM_002496.2  
GGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGACCACGCCTATGCTGCTG
HKR182530 ARi56F10 pGCAP10 NM_002496.2  
GGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGACCAC
HKR184010 ARi60A10 pGCAP10 NM_002496.2  
GGCCTCCCGATTGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGC
HKR205471 ARiS013L07 pGCAP10 NM_002496.2  
GGATTGNNTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGA
HKR234319 ARiS085N07 pGCAP10 NM_002496.2  
TGGTTTTTTGGCCGTGAAAGTCGGGCTTGGGCAGCGTGGCGTCGGGGGCGAGTGTGGTGT
HKR235563 ARiS088P03 pGCAP10 NM_002496.2  
TGACNNGGCCTTGCTNGGCAAGGCAAGTAGCGGCGGCGCTTCAAGNNGCGCTGCCTGACC
HKR320956 RBb02G12 pKA1U5 NM_002496.2  
GCTCCCGATTGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTG
HKR345233 RBb63B09 pGCAP1 NM_002496.2  
GGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGACCAC
HKR362408 RBd06A08 pGCAP10 NM_002496.2  
GAGCCTCCGCCTCCCGATTGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAA
HKR369683 RBd24D11 pGCAP10 NM_002496.2  
GGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGACCAC
HKR441660 RBdS104C12 pGCAP10 NM_002496.2  
GGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGATGCGCTGCCTGACCAC
HKR442220 RBdS105J04 pGCAP10 NM_002496.2  
GGACTGGCCTGCTTGGCAAGGCAAGTAGCGGCGGCGCTTCAAGGCCATCACCATCGAGGC
HKR444383 RBdS110P23 pGCAP10 NM_002496.2  
GGGCGCTTCAAGATGCGCTGCCTGACCACGCCTATGCTGCTGCGGGCCCTGGCCCAGGCT
HKR461663 RBdS154C15 pGCAP10 NM_002496.2  
GAGGGCGCATGCGCCGCCCGCTCTGCGCCACCGGCCTAGTTAGGGTCGGAGATCACTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl