Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFS6

Gene ID (NCBI) 4726
Gene Symbol NDUFS6
Protein Name NADH dehydrogenase (ubiquinone) Fe-S protein 6, 13kDa (NADH-coenzyme Q reductase)
Synonyms CI-13kA|CI-13kD-A|CI13KDA
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX025776 IRAK064H08 pCMV-SPORT6 BC038664 NM_004553 Full
HGX043082 IRAK107L18 pCMV-SPORT6 BC046155 NM_004553 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR165602 ARi14A02 pGCAP10 NM_004553.3
GGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTGAACCGGTGTGGCGAGGCG
HKR054502 ARe36E06 pKA1U5 NM_004553.3
GGCCGGGTCAAAGGCCAGCGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTG
HKR322011 RBb05A11 pKA1U5 NM_004553.3
TGGGCCAGCGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTGAACCGGTGTG
HKR336002 RBb40A02 pGCAP1 NM_004553.3
GAGCGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTGAACCGGTGTGGCGAG
HKR387775 RBd69H07 pGCAP10 NM_004553.3
GAAAGGCCAGCGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTGAACCGGTG
HKR394527 RBd86F07 pGCAP10 NM_004553.3
GCAGCGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTGAACCGGTGTGGCGA
HKR442343 RBdS105O07 pGCAP10 NM_004553.3
GGGGTCAAAGGCCAGCGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl