Prev. |  KEGG KO K03938 > 

RIKEN DNA Bank Human Resource - NDUFS5

Gene ID NCBI Gene 4725 |  KEGG hsa:4725
Gene Symbol NDUFS5
Protein Name NADH:ubiquinone oxidoreductase subunit S5
Synonyms CI-15k|CI15K
Ortholog resources KEGG ortholog (KEGG orthology K03938) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083520 IRAL008N08 pOTB7 BC001884 NM_004552 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097617 M01C044A17 pDONR221 MGC11-E09 BC001884 NM_004552  
HGE097665 M01C044C17 pDONR221 MGC11-E09 BC001884 NM_004552  
HGE097713 M01C044E17 pDONR221 MGC11-E09 BC001884 NM_004552  
HGE097761 M01C044G17 pDONR221 MGC11-E09 BC001884 NM_004552  
HGE097809 M01C044I17 pDONR221 MGC11-E09 BC001884 NM_004552  
HGE097857 M01C044K17 pDONR221 MGC11-E09 BC001884 NM_004552  
HGE097905 M01C044M17 pDONR221 MGC11-E09 BC001884 NM_004552  
HGE097953 M01C044O17 pDONR221 MGC11-E09 BC001884 NM_004552  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076974 ARe92H06 pKA1U5 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTT
HKR078132 ARe95F12 pKA1U5 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTT
HKR162173 ARi05H05 pGCAP10 NM_004552.1  
GGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTTCTTG
HKR171346 ARi28G02 pGCAP10 NM_004552.1  
GGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTTCTTGGACATCCAGAAAAGGTTCGG
HKR174532 ARi36F12 pGCAP10 NM_004552.1  
GGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTTCTTGGACATCCAGAAAAGGTTCGG
HKR187604 ARi69A04 pGCAP10 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTT
HKR188155 ARi70G11 pGCAP10 NM_004552.1  
CGATGGTTGACAATCCAGAGTGGTGAACAGCCCTACAAGATGGCTGGTCGATGCCATGCT
HKR322426 RBb06B02 pKA1U5 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTT
HKR323673 RBb09D01 pKA1U5 NM_004552.1  
GACGGCAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAA
HKR325605 RBb14A05 pKA1U5 NM_004552.1  
GAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTTCTTGGACATCCAGAAAAGGTT
HKR325660 RBb14C12 pKA1U5 NM_004552.1  
HKR326078 RBb15D06 pKA1U5 NM_004552.1  
GAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTTCTTGGACATCCAGAAAAGGTT
HKR332452 RBb31C04 pGCAP1 NM_004552.1  
GAGGCAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAG
HKR332531 RBb31F11 pGCAP1 NM_004552.1  
HKR334001 RBb35A01 pGCAP1 NM_004552.1  
GGGGTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCC
HKR335258 RBb38C10 pGCAP1 NM_004552.1  
GAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCA
HKR336522 RBb41F02 pGCAP1 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGGTAGCCATGC
HKR341750 RBb54G06 pGCAP1 NM_004552.1  
GGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGG
HKR362900 RBd07E04 pGCAP10 NM_004552.1  
GGTCATCCTTTACGGCAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGA
HKR363324 RBd08F04 pGCAP10 NM_004552.1  
GGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGG
HKR365755 RBd14G11 pGCAP10 NM_004552.1  
GAGTCGTTCTGANNCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGGTAGCCATGC
HKR370123 RBd25F03 pGCAP10 NM_004552.1  
GACGGCAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAA
HKR378907 RBd47E11 pGCAP10 NM_004552.1  
GATCCTTTACGGCAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAA
HKR379228 RBd48B04 pGCAP10 NM_004552.1  
TGAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTT
HKR382126 RBd55F06 pGCAP10 NM_004552.1  
TAAAGTGGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGNATCGGGTAGCCAT
HKR385273 RBd63D01 pGCAP10 NM_004552.1  
GATCCTTTACGGCAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAA
HKR386831 RBd67B07 pGCAP10 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGGTAGCCATGC
HKR389612 RBd74A12 pGCAP10 NM_004552.1  
GGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATC
HKR391328 RBd78F08 pGCAP10 NM_004552.1  
GGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATC
HKR394879 RBd87D07 pGCAP10 NM_004552.1  
GAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCA
HKR396076 RBd90D04 pGCAP10 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGGTAGCCATGC
HKR406378 RBdS015P18 pGCAP10 NM_004552.1  
TGGAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCT
HKR441677 RBdS104D05 pGCAP10 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGGTAGCCATGC
HKR442189 RBdS105H21 pGCAP10 NM_004552.1  
GAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCCTTT
HKR461822 RBdS154J06 pGCAP10 NM_004552.1  
AGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAAGGGCACGAGCATCGGCCATGCC
HKR470974 RBdS177H06 pGCAP10 NM_004552.1  
GACGGCAGGCGTCCGCGTCGCTAGCTAGTCGTTCTGAAGCGGCGGCCAGAGAAGAGTCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl