Prev. |  KEGG KO K03935 > 

RIKEN DNA Bank Human Resource - NDUFS2

Gene ID NCBI Gene 4720 |  KEGG hsa:4720
Gene Symbol NDUFS2
Protein Name NADH:ubiquinone oxidoreductase core subunit S2
Synonyms CI-49|MC1DN6
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  NDUFS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001345 IRAK003G01 pCMV-SPORT6 BC000170 NM_004550 Full
HGY081781 IRAL004H13 pOTB7 BC001456 NM_004550 Full
HGY090659 IRAL026K19 pOTB7 BC008868 NM_004550

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR264412 ARiS161A12 pGCAP10 NM_004550.4  
GAGTCTGCAGCCGGAGTAAGATGGCGGCGCTGAGGGCTTTGTGCGGCTTCCGGGGCGTCG
HKR363778 RBd09H10 pGCAP10 NM_004550.4  
GCTGCAGCCGGAGTAAGATGGCGGCGCTGAGGGCTTTGTGCGGCTTCCGGGGCGTCGCGG
HKR385201 RBd63A01 pGCAP10 NM_004550.4  
GGCAGTCTGCAGCCGGAGTAAGATGGCGGCGCTGAGGGCTTTGTGCGGCTTCCGGGGCGT
HKR387275 RBd68D03 pGCAP10 NM_004550.4  
GAGTCTGCAGCCGGAGTAAGATGGCGGCGCTGAGGGCTTTGTGCGGCTTCCGGGGCGTCG
HKR406233 RBdS015J17 pGCAP10 NM_004550.4  
GAGTCTGCAGCCGGAGTAAGATGGCGGCGCTGAGGGCTTTGTGCGGCTTCCGGGGCGTCG
HKR475046 RBdS187K06 pGCAP10 NM_004550.4  
GGTAAGATGGCGGCGCTGAGGGCTTTGTGCGGCTTCCGGGGCGTCGCGGCCCAGGTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl