Prev. |  KEGG KO K03934 > 

RIKEN DNA Bank Human Resource - NDUFS1

Gene ID NCBI Gene 4719 |  KEGG hsa:4719
Gene Symbol NDUFS1
Protein Name NADH:ubiquinone oxidoreductase core subunit S1
Synonyms CI-75Kd|CI-75k|MC1DN5|PRO1304
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  NDUFS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013168 IRAK032P08 pBluescriptR BC030833 NM_005006 Full/var
HGY095034 IRAL037J18 pDNR-LIB BC022368 NM_005006 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234005 ARiS085A05 pGCAP10 NM_005006.5  
GATATTGAATAAGCGACCCGGCCTCCTAGGGGGTCGTCGTGGTCCAGACAGTTTAGCAGA
HKR346429 RBb66B05 pGCAP1 NM_005006.5  
HKR406257 RBdS015K17 pGCAP10 NM_005006.5  
GGCCGAGGCCGCCATATTGAATAAGCGACCCGGCCTCCTAGGGGGTCGTCGTGGTCCAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl