Prev. |  KEGG KO K03964 > 

RIKEN DNA Bank Human Resource - NDUFB8

Gene ID NCBI Gene 4714 |  KEGG hsa:4714
Gene Symbol NDUFB8
Protein Name NADH:ubiquinone oxidoreductase subunit B8
Synonyms ASHI|CI-ASHI
Ortholog resources KEGG ortholog (KEGG orthology K03964) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080625 IRAL001J09 pOTB7 BC000466 NM_005004 Full
HGY083983 IRAL009P23 pOTB7 BC019276 NM_005004 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097642 M01C044B18 pDONR221 MGC11-H09 BC019276 NM_005004  
HGE097690 M01C044D18 pDONR221 MGC11-H09 BC019276 NM_005004  
HGE097738 M01C044F18 pDONR221 MGC11-H09 BC019276 NM_005004  
HGE097786 M01C044H18 pDONR221 MGC11-H09 BC019276 NM_005004  
HGE097834 M01C044J18 pDONR221 MGC11-H09 BC019276 NM_005004  
HGE097882 M01C044L18 pDONR221 MGC11-H09 BC019276 NM_005004  
HGE097930 M01C044N18 pDONR221 MGC11-H09 BC019276 NM_005004  
HGE097978 M01C044P18 pDONR221 MGC11-H09 BC019276 NM_005004  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044803 ARe12A03 pKA1U5 NM_005004.2  
GAAACGTGAAGAAGGTGAAGATGGCGGTGGCCAGGGCCGGGGTCTTGGGAGTCCAGTGGC
HKR165723 ARi14F03 pGCAP10 NM_005004.2  
GGAAGAAGGTGAAGATGGCGGTGGCCAGGGCCGGGGTCTTGGGAGTCCAGTGGCTGCAAA
HKR276557 ARiS191G13 pGCAP10 NM_005004.2  
GGAAGAAGGTGAAGATGGCGGTGGCCAGGGCCGGGGTCTTGGGAGTCCAGTGGCTGCAAA
HKR322484 RBb06D12 pKA1U5 NM_005004.2  
GGCAGAAGGGAAACGTGAAGAAGGTGAAGATGGCGGTGGCCAGGGCCGGGGTCTTGGGAG
HKR326460 RBb16C12 pKA1U5 NM_005004.2  
GAAGAAGGTGAAGATGGCGGTGGCCAGGGCCGGGGTCTTGGGAGTCCAGTGGCTGCAAAG
HKR379353 RBd48G09 pGCAP10 NM_005004.2  
GAAGGGAAACGTGAAGAAGGTGAAGATGGCGGTGGCCAGGGCCGGGGTCTTGGGAGTCCA
HKR381607 RBd54A07 pGCAP10 NM_005004.2  
GGCAGAAGGGAAACGTGAAGAAGGTGAAGATGGCGGTGGCCNGNNNNCGGGGTCTTGGGA
HKR420568 RBdS051G24 pGCAP10 NM_005004.2  
GAGAAGGGAAACGTGAAGAAGGTGAAGATGGCGGTGGCCAGGGCCGGGGTCTTGGGAGTC
HKR470939 RBdS177F19 pGCAP10 NM_005004.2  
AAAAAAAACGTGAAGAAGGTGAAGATGGCGGTGGCCAGGGCCGGGGTCTTGGGAGTCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl