Prev. |  KEGG KO K03963 > 

RIKEN DNA Bank Human Resource - NDUFB7

Gene ID NCBI Gene 4713 |  KEGG hsa:4713
Gene Symbol NDUFB7
Protein Name NADH:ubiquinone oxidoreductase subunit B7
Synonyms B18|CI-B18
Ortholog resources KEGG ortholog (KEGG orthology K03963) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081818 IRAL004J02 pOTB7 BC002595 NM_004146 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE039740 W01A099F20 pENTR-TOPO IRAL004J02 BC002595 NM_004146  
HGE039772 W01A099H04 pENTR-TOPO IRAL004J02 BC002595 NM_004146  
HGE039774 W01A099H06 pENTR-TOPO IRAL004J02 BC002595 NM_004146  
HGE039776 W01A099H08 pENTR-TOPO IRAL004J02 BC002595 NM_004146  
HGE050557 W01A126G13 pENTR-TOPO IRAL004J02 BC002595 NM_004146  
HGE050559 W01A126G15 pENTR-TOPO IRAL004J02 BC002595 NM_004146  
HGE050561 W01A126G17 pENTR-TOPO IRAL004J02 BC002595 NM_004146  
HGE050563 W01A126G19 pENTR-TOPO IRAL004J02 BC002595 NM_004146  
HGE050565 W01A126G21 pENTR-TOPO IRAL004J02 BC002595 NM_004146  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043609 ARe09A09 pKA1U5 NM_004146.4  
GGTCAGCTGGCTTCCGGGTAGGAGCTAGGATGACCCTTCGGCTGCTGCAGGGTATCTGCA
HKR050406 ARe26A06 pKA1U5 NM_004146.4  
GGTCAGTGGTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCAGCGAC
HKR054505 ARe36E09 pKA1U5 NM_004146.4  
GGTCAGTGGTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCAGCGAC
HKR063601 ARe59A01 pKA1U5 NM_004146.4  
GGTCAGTGGTTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCAGCGA
HKR063729 ARe59F09 pKA1U5 NM_004146.4  
ATCCTGGAGTGGTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCAGC
HKR074410 ARe86A10 pKA1U5 NM_004146.4  
GAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCAGCGACTGCAGCCATGGGGGCG
HKR078481 ARe96D09 pKA1U5 NM_004146.4  
GGAGGGGTCAGTGGTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCA
HKR260017 ARiS150A17 pGCAP10 NM_004146.4  
GGATCTGCNGCGACTGCAGCCATGGGGGCGCACCTGGTCCGGCGCTACCTGGGCGATGCC
HKR264628 ARiS161J12 pGCAP10 NM_004146.4  
GACCCTCGGCTGCTGCAGGGATCTGCAGCGACTGCAGCCATGGGGGCGCACCTGGTCCGG
HKR369275 RBd23D03 pGCAP10 NM_004146.4  
GAGTGGTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCAGCGACTGC
HKR372051 RBd30C03 pGCAP10 NM_004146.4  
GAGGGGTCAGTGGTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCAG
HKR442020 RBdS105A20 pGCAP10 NM_004146.4  
GGAGGGGTCAGTGGTTCCGGGTAGGAGCTAGGTGACCCTCGGCTGCTGCAGGGATCTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl