Prev. |  KEGG KO K03962 > 

RIKEN DNA Bank Human Resource - NDUFB6

Gene ID NCBI Gene 4712 |  KEGG hsa:4712
Gene Symbol NDUFB6
Protein Name NADH:ubiquinone oxidoreductase subunit B6
Synonyms B17|CI
Ortholog resources KEGG ortholog (KEGG orthology K03962) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020528 IRAK051F08 pCMV-SPORT6 BC029247 NM_182739 Full/var
HGY087961 IRAL019P01 pDNR-LIB BC009801 NM_182739 Full/var
HGY092915 IRAL032E19 pDNR-LIB BC016708 NM_182739 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056526 ARe41F06 pKA1U5 NM_002493.3  
AAGTTAACTAGTCCGTAGTTCGAGGGTGCGCCGCTGCTCCTTTTGCGTTGGTACCAGCGG
HKR172007 ARi30A07 pGCAP10 NM_002493.3  
TAAGTAACTAGTCCGTAGTTCGAGGGTGCGCCGTGTCCTTTTGCGTTGGTACCAGCGGCG
HKR219711 ARiS049E15 pGCAP10 NM_002493.3  
GAGAGCGGGAGCGCGCTTAAGTAACTAGTCCGTAGTTCGAGGGTGCGCCGTGTCCTTTTG
HKR277936 ARiS194N24 pGCAP10 NM_002493.3  
GGTCCTTTTGCGTTGGTACCAGCGGCGACATGACGGGGTACACTCCGGATGAGAAACTGC
HKR342806 RBb57A06 pGCAP1 NM_002493.3  
GGTCCTTTTGCGTTGGTACCAGCGGCGACATGACGGGGTACACTCCGGATGAGAAACTGC
HKR396831 RBd92B07 pGCAP10 NM_002493.3  
GAGTCCGTAGTTCGAGGGTGCGCCGTGTCCTTTTGCGTTGGTACCAGCGGCGACATGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl