Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFB5

Gene ID (NCBI) 4711
Gene Symbol NDUFB5
Protein Name NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa
Synonyms CISGDH|SGDH
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086672 IRAL016L08 pDNR-LIB BC005271 NM_002492 Full
HGY087892 IRAL019M04 pDNR-LIB BC009796 NM_002492 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR165780 ARi14H12 pGCAP10 NM_002492.2
GCTCCTGCCCGTAGTAGCCATGGCGGCCATGAGTTTGTTGCGGCGGGTTTCGGTTACTGC
HKR053625 ARe34B01 pKA1U5 NM_002492.2
GAGTAGCCATGGCGGCCATGAGTTTGTTGCGGCGGGTTTCGGTTACTGCGGTGGCAGCTC
HKR068075 ARe70D03 pKA1U5 NM_002492.2
AAATTGGTAGTAGCCATGGCGGCCATGAGTTTGTTGCGGCGGGTTTCGGTTACTGCGGTG
HKR329625 RBb24B01 pGCAP1 NM_002492.2
GNGTNCGCCACGGGGCGTCCANGGAGCGTNGGATAGNCGCGGGTNCCCNTTTACTGCTGT
HKR369299 RBd23E03 pGCAP10 NM_002492.2
GAAACACTTTTTTTTTTATCTTAGAGATTCTACATTGCATTGACTGGGATTCCAGTAGCA
HKR371652 RBd29C04 pGCAP10 NM_002492.2
GCTCCTGCCCGTAGTAGCCATGGCGGCCATGAGTTTGTTGCGGCGGGTTTCGGTTACTGC
HKR394454 RBd86C06 pGCAP10 NM_002492.2
GAGTAGCCATGGCGGCCATGAGTTTGTTGCGGCGGGTTTCGGTTACTGCGGTGGCAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl