Prev. |  KEGG KO K03957 > 

RIKEN DNA Bank Human Resource - NDUFB1

Gene ID NCBI Gene 4707 |  KEGG hsa:4707
Gene Symbol NDUFB1
Protein Name NADH:ubiquinone oxidoreductase subunit B1
Synonyms CI-MNLL|CI-SGDH|MNLL
Ortholog resources KEGG ortholog (KEGG orthology K03957) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005943 IRAK014O07 pCMV-SPORT6 BC009691 NM_004545 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040556 ARe01G12 pKA1U5 NM_004545.3  
GGCGGGTTGAGTTCCCTGNTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGGCTGCA
HKR066059 ARe65C11 pKA1U5 NM_004545.3  
GAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGGCTGCAGCTATCATG
HKR178945 ARi47G01 pGCAP10 NM_004545.3  
GGCTAGATTATCGAATGTTCACATTTTAAAGTTCTGAGAGAAATAAAAACATGAAGAATT
HKR181323 ARi53F03 pGCAP10 NM_004545.3  
CACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGG
HKR183601 ARi59A01 pGCAP10 NM_004545.3  
GACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGG
HKR186834 ARi67B10 pGCAP10 NM_004545.3  
GGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGGCTGCAGCTATCATGG
HKR203371 ARiS008H03 pGCAP10 NM_004545.3  
GGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGGCTGCAGCTATCAT
HKR208296 ARiS020M08 pGCAP10 NM_004545.3  
GCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGGCTGCAGCTATCATGGTGAA
HKR209296 ARiS023D24 pGCAP10 NM_004545.3  
GACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGG
HKR243931 ARiS109N19 pGCAP10 NM_004545.3  
GGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGGCTG
HKR332050 RBb30C02 pGCAP1 NM_004545.3  
GGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGGCTGCAGCTATCATGGTGAACTTACT
HKR334825 RBb37B01 pGCAP1 NM_004545.3  
GCCACTGGCGCGGGTTGAGTTCCCTGNTTGCCCTTGGTCTCGGGGTCGCTGNTAGGCGCA
HKR360523 RBd01F03 pGCAP10 NM_004545.3  
GACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGG
HKR374005 RBd35A05 pGCAP10 NM_004545.3  
GGCTCCGTGCGGGCGCGGCGAATGGCAGGTCCCGAGGTCGCAGCTTCCACTGGCGCGGGT
HKR387731 RBd69F11 pGCAP10 NM_004545.3  
TGGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGGCTGCAGCTATCA
HKR388004 RBd70A04 pGCAP10 NM_004545.3  
CGGCCGGCCGATGGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGGC
HKR389700 RBd74E04 pGCAP10 NM_004545.3  
GGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGGCTGCAGCTATCAT
HKR390012 RBd75A12 pGCAP10 NM_004545.3  
TGGGCCCGAGGTCGCAGCTTCCACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCG
HKR392479 RBd81D07 pGCAP10 NM_004545.3  
GGTAGGCGCTGAGGCTGCAGCTATCATGGTGAACTTACTTCAGATTGTGCGGGACCACTG
HKR398173 RBd95H05 pGCAP10 NM_004545.3  
GACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGG
HKR405257 RBdS013C09 pGCAP10 NM_004545.3  
GGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGGCTGCAG
HKR408966 RBdS022G22 pGCAP10 NM_004545.3  
GACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGG
HKR430282 RBdS075L18 pGCAP10 NM_004545.3  
GACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGG
HKR433516 RBdS083N04 pGCAP10 NM_004545.3  
GGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTCGGCGCTGAGGCTGCAGCTATCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl