Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFA10

Gene ID (NCBI) 4705
Gene Symbol NDUFA10
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Synonyms CI-42KD|CI-42k
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001296 IRAK003D24 pCMV-SPORT6 BC003417 NM_004544 Full
HGY097379 IRAL043H11 pOTB7 BC031332 NM_004544 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR044948 ARe12G04 pKA1U5 NM_004544.2
GGAGAGAGGGCCCCGNTCGCGACCGCGTCCCCTNNGNTTCCTTGATCCTGAGCTGACCGG
HKR056483 ARe41D11 pKA1U5 NM_004544.2
GCCCCTTGGGTCCTTGATCCTGAGCTGACCGGGTAGCCATGGCCTTGCGGCTCCTGAAGC
HKR180882 ARi52D10 pGCAP10 NM_004544.2
GGTCGCGACCGCGTCCCCTTGGGTCCTTGATCCTGAGCTGACCGGGTAGCCATGGCCTTG
HKR462553 RBdS156G09 pGCAP10 NM_004544.2
GCCTTGGGTCCTTGATCCTGAGCTGACCGGGTAGCCATGGCCTTGCGGCTCCTGAAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl