Prev. |  KEGG KO K03954 > 

RIKEN DNA Bank Human Resource - NDUFA10

Gene ID NCBI Gene 4705 |  KEGG hsa:4705
Gene Symbol NDUFA10
Protein Name NADH:ubiquinone oxidoreductase subunit A10
Synonyms CI-42KD|CI-42k|MC1DN22
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  NDUFA10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001296 IRAK003D24 pCMV-SPORT6 BC003417 NM_004544 Full
HGY097379 IRAL043H11 pOTB7 BC031332 NM_004544 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044948 ARe12G04 pKA1U5 NM_004544.2  
GGAGAGAGGGCCCCGNTCGCGACCGCGTCCCCTNNGNTTCCTTGATCCTGAGCTGACCGG
HKR056483 ARe41D11 pKA1U5 NM_004544.2  
GCCCCTTGGGTCCTTGATCCTGAGCTGACCGGGTAGCCATGGCCTTGCGGCTCCTGAAGC
HKR180882 ARi52D10 pGCAP10 NM_004544.2  
GGTCGCGACCGCGTCCCCTTGGGTCCTTGATCCTGAGCTGACCGGGTAGCCATGGCCTTG
HKR462553 RBdS156G09 pGCAP10 NM_004544.2  
GCCTTGGGTCCTTGATCCTGAGCTGACCGGGTAGCCATGGCCTTGCGGCTCCTGAAGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl