Prev. |  KEGG KO K03951 > 

RIKEN DNA Bank Human Resource - NDUFA7

Gene ID NCBI Gene 4701 |  KEGG hsa:4701
Gene Symbol NDUFA7
Protein Name NADH:ubiquinone oxidoreductase subunit A7
Synonyms B14.5a|CI-B14.5a
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  NDUFA7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083477 IRAL008L13 pOTB7 BC003102 NM_005001

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097604 M01C044A04 pDONR221 MGC11-F02 BC003102 NM_005001  
HGE097652 M01C044C04 pDONR221 MGC11-F02 BC003102 NM_005001  
HGE097700 M01C044E04 pDONR221 MGC11-F02 BC003102 NM_005001  
HGE097748 M01C044G04 pDONR221 MGC11-F02 BC003102 NM_005001  
HGE097796 M01C044I04 pDONR221 MGC11-F02 BC003102 NM_005001  
HGE097844 M01C044K04 pDONR221 MGC11-F02 BC003102 NM_005001  
HGE097892 M01C044M04 pDONR221 MGC11-F02 BC003102 NM_005001  
HGE097940 M01C044O04 pDONR221 MGC11-F02 BC003102 NM_005001  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074075 ARe85D03 pKA1U5 NM_005001.2  
GCCCTTCAGTATCGCGGACGGAAGATGGCGTCCGCCACCCGNTCTCATCCAGCGGCTGCG
HKR370449 RBd26C01 pGCAP10 NM_005001.2  
GAGTATCGCGGACGGAAGATGGCGTCCGCCACCCGTCTCATCCAGCGGCTGCGGAACTGG
HKR403173 RBdS007P13 pGCAP10 NM_005001.2  
TGATCGCGGACGGAAGATGGCGTCCGCCACCCGTCTCATCCAGCGGCTGCGGAACTGGGC
HKR420412 RBdS051A12 pGCAP10 NM_005001.2  
GAGTATCGCGGACGGAAGATGGCGTCCGCCACCCGTCTCATCCAGCGGCTGCGGAACTGG
HKR420620 RBdS051J04 pGCAP10 NM_005001.2  
GAGTATCGCGGACGGAAGATGGCGTCCGCCACCCGTCTCATCCAGCGGCTGCGGAACTGG
HKR452801 RBdS132A01 pGCAP10 NM_005001.2  
GAGCCCGCCGCCCGCCGCCCGCCGCCCGGGCCACTGCAGGGGCCGCTAACGGTCCGGCGC
HKR452825 RBdS132B01 pGCAP10 NM_005001.2  
GAGTATCGCGGACGGAAGATGGCGTCCGCCACCCGTCTCATCCAGCGGCTGCGGAACTGG
HKR474910 RBdS187E14 pGCAP10 NM_005001.2  
GAGTATCGCGGACGGAAGATGGCGTCCGCCACCCGTCTCATCCAGCGGCTGCGGAACTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl