Prev. |  KEGG KO K03950 > 

RIKEN DNA Bank Human Resource - NDUFA6

Gene ID NCBI Gene 4700 |  KEGG hsa:4700
Gene Symbol NDUFA6
Protein Name NADH:ubiquinone oxidoreductase subunit A6
Synonyms B14|CI-B14|LYRM6|MC1DN33|NADHB14
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Ortholog resource in our bank

  NDUFA6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084843 IRAL012B19 pOTB7 BC002772 NM_002490 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072155 ARe80G11 pKA1U5 NM_002490.3  
GGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTTCTACCGCCAGCACCTTCGTGAA
HKR176483 ARi41D11 pGCAP10 NM_002490.3  
GGGGGTTGTGGAGTGGATGCTTTGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTT
HKR276717 ARiS191N05 pGCAP10 NM_002490.3  
GGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTTCTACCGCCAGCACCTTCGTGAA
HKR339628 RBb49B04 pGCAP1 NM_002490.3  
GATGCTTTGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTTCTACCGCCAGCACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl