Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFA6

Gene ID (NCBI) 4700
Gene Symbol NDUFA6
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa
Synonyms B14|CI-B14|LYRM6|NADHB14
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084843 IRAL012B19 pOTB7 BC002772 NM_002490 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR176483 ARi41D11 pGCAP10 NM_002490.3
GGGGGTTGTGGAGTGGATGCTTTGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTT
HKR072155 ARe80G11 pKA1U5 NM_002490.3
GGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTTCTACCGCCAGCACCTTCGTGAA
HKR276717 ARiS191N05 pGCAP10 NM_002490.3
GGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTTCTACCGCCAGCACCTTCGTGAA
HKR339628 RBb49B04 pGCAP1 NM_002490.3
GATGCTTTGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTTCTACCGCCAGCACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl