Prev. |  KEGG KO K03949 > 

RIKEN DNA Bank Human Resource - NDUFA5

Gene ID NCBI Gene 4698 |  KEGG hsa:4698
Gene Symbol NDUFA5
Protein Name NADH:ubiquinone oxidoreductase subunit A5
Synonyms B13|CI-13KD-B|CI-13kB|NUFM|UQOR13
Ortholog resources KEGG ortholog (KEGG orthology K03949) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001763 IRAK004G19 pCMV-SPORT6 BC000813 NM_005000 Full
HGY094819 IRAL037A19 pDNR-LIB BC020821 NM_005000 Full
HGY102854 IRAL057C06 pDNR-LIB BC070236 NM_005000 Full/var
HGY102904 IRAL057E08 pDNR-LIB BC070237 NM_005000 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051625 ARe29B01 pKA1U5 NM_005000.2  
GGTTGGCGCTGTCATGGCGGGTGTGCTGAAGAAGACCACTGGCCTTGTGGGATTGGCTGT
HKR078006 ARe95A06 pKA1U5 NM_005000.2  
GACCGAGTCGTTGGCGCTGTCATGGCGGGTGTGCTGAAGAAGACCACTGGCCTTGTGGGA
HKR331204 RBb28A04 pGCAP1 NM_005000.2  
AATGTGGAAAGGGTTGTGCGTCACCGAGTCGTTGGCGCTGTCATGGCGGGTGTGCTGAAG
HKR370880 RBd27D08 pGCAP10 NM_005000.2  
GGGGGGCTGTCGGCTTTGGTGTGCGAACTAGTACCACTGGCCGTGTGGGATTGGCTGTGT
HKR442041 RBdS105B17 pGCAP10 NM_005000.2  
GGTCACCGAGTCGTTGGCGCTGTCATGGCGGGTGTGCTGAAGAAGACCACTGGCCTTGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl