Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NDUFA2

Gene ID (NCBI) 4695
Gene Symbol NDUFA2
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa
Synonyms B8|CD14|CIB8
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086534 IRAL016F14 pDNR-LIB BC003674 NM_002488 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE096402 M01C041A02 pDONR221 MGC10-B01 BC003674 NM_002488
HGE096450 M01C041C02 pDONR221 MGC10-B01 BC003674 NM_002488
HGE096498 M01C041E02 pDONR221 MGC10-B01 BC003674 NM_002488
HGE096546 M01C041G02 pDONR221 MGC10-B01 BC003674 NM_002488
HGE096594 M01C041I02 pDONR221 MGC10-B01 BC003674 NM_002488
HGE096642 M01C041K02 pDONR221 MGC10-B01 BC003674 NM_002488
HGE096690 M01C041M02 pDONR221 MGC10-B01 BC003674 NM_002488
HGE096738 M01C041O02 pDONR221 MGC10-B01 BC003674 NM_002488

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR173232 ARi33B08 pGCAP10 NM_002488.3
GGCACTTGGCCTGAAGACCTGGAATTGGCGACTTCGATATTAACAAGGATGGCGGCGGCC
HKR059254 ARe48C06 pKA1U5 NM_002488.3
GAGACCGGAGCACTTGGCCTGAAGACCTGGAATTGGCGACTTCGATATTAACAAGGATGG
HKR235527 ARiS088N15 pGCAP10 NM_002488.3
GCTGGAATTGGCGACTTCGATATTAACAAGGATGGCGGCGGCCGCAGCAAGTCGAGGAGT
HKR248941 ARiS122F21 pGCAP10 NM_002488.3
GACTTGGCCTGAAGACCTGGAATTGGCGACTTCGATATTAACAAGGATGGCGGCGGCCGC
HKR364074 RBd10D02 pGCAP10 NM_002488.3
GAGAAATTGACCTCGCAGCGGTCCTACAATACTTTTATATCATTGGCCAAGCTTTACCCC
HKR329302 RBb23E06 pGCAP1 NM_002488.3
GACCTGGAATTGGCGACTTCGATATTAACAAGGATGGCGGCGGCCGCAGCAAGTCGAGGA
HKR378025 RBd45B01 pGCAP10 NM_002488.3
GAGCACTTGGCCTGAAGACCTGGAATTGGCGACTTCGATATTAACAAGGATGGCGGCGGC
HKR348928 RBb72F08 pGCAP1 NM_002488.3
TGGCACTTGGCCTGAAGACCTGGAATTGGCGACTTCGATATTAACAAGGATGGCGGCGGC
HKR391256 RBd78C08 pGCAP10 NM_002488.3
GACTTGGCCTGAAGACCTGGAATTGGCGACTTCGATATTAACAAGGATGGCGGCGGCCGC
HKR430057 RBdS075C09 pGCAP10 NM_002488.3
GGCTCTTGGNCTGAANACCAGAAATTGGCNACTTCNATATNAACAAGGATGGNGGCNGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl