Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCK1

Gene ID (NCBI) 4690
Gene Symbol NCK1
Protein Name NCK adaptor protein 1
Synonyms NCK|NCKalpha|nck-1
Databases KEGG hsa:4690 |  NCBI Gene 4690
Featured content T cell receptor signaling pathway (human)
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07365)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087179 IRAL017P19 pOTB7 BC006403 NM_006153

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082907 ARf07E11 pKA1U5 NM_006153.3  
ATCCTGGCCTCTCTCCCAAGAGCTACGCGGCGGCGGNGGAGCGCAGGCCTCGTGCCGTTA
HKR320811 RBb02A11 pKA1U5 NM_006153.3  
GAGGCCTCGTGCCGTTACGGCCATCACGGCGGCCGCAGNTGGCGTCCTGGAGCCCTCCTC
HKR408856 RBdS022C08 pGCAP10 NM_006153.3  
GGTGCCGTTACGGCCATCACGGCGGCCGCAGTGGCGTCCTGGAGCCCTCCTCAGGTGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl