Prev. |  KEGG KO K12882 > 

RIKEN DNA Bank Human Resource - NCBP1

Gene ID NCBI Gene 4686 |  KEGG hsa:4686
Gene Symbol NCBP1
Protein Name nuclear cap binding protein subunit 1
Synonyms CBP80|NCBP|Sto1
Ortholog resource in our bank

  NCBP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081737 IRAL004F17 pOTB7 BC001450 NM_002486 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008489 W01A021D17 pENTR-TOPO IRAL004F17 BC001450 NM_002486  
HGE008493 W01A021D21 pENTR-TOPO IRAL004F17 BC001450 NM_002486  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347258 RBb68C10 pGCAP1 NM_002486.4  
GCTCTCGGTTCCGCGGCGCACCGGAGGGCAGCATGTCGCGGCGGCGGCACAGCGACGAGA
HKR405741 RBdS014F21 pGCAP10 NM_002486.4  
GAGACAGTTCCTGCAGCGCTTACCGCCTGGCCTCTCGGTTCCGCGGCGCACCGGAGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl