Prev. | 

RIKEN DNA Bank Human Resource - NUBP1

Gene ID NCBI Gene 4682 |  KEGG hsa:4682
Gene Symbol NUBP1
Protein Name nucleotide binding protein 1
Synonyms CIAO5|NBP|NBP1|NBP35
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079308 ARe98E12 pKA1U5 NM_002484.2  
GGGCAAAGGCGACGGAATGGAGGAGGTGCCTCACGACTGTCCAGGGGCCGACAGCGCCCA
HKR374480 RBd36D08 pGCAP10 NM_002484.2  
GGTTCCGGTGACCACGAAGGCGGCAAAGGCGACGGAATGGAGGAGGTGCCTCACGACTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl