Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NASP

Gene ID (NCBI) 4678
Gene Symbol NASP
Protein Name nuclear autoantigenic sperm protein (histone-binding)
Synonyms FLB7527|PRO1999
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11291)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX046214 IRAK115I22 pCMV-SPORT6 BC053608 NM_152298 Full
HGY082448 IRAL006B24 pOTB7 BC003113 NM_152298 Full
HGY086278 IRAL015L14 pOTB7 BC009933 NM_002482 Partial/var
HGY090904 IRAL027E08 pOTB7 BC010105 NM_002482 Full
HGY091699 IRAL029E03 pOTB7 BC011580 NM_002482 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070173 ARe75H05 pKA1U5 NM_002482.2  
GAATCTGCCATTTTCTGTCCCTGAAGTGAGTCTCCGGNGTCCCAAATTGCCTGTTTTTCT
HKR368176 RBd20H08 pGCAP10 NM_002482.2  
GAATCTGCCATTTTCTGTCCCTGAGTGAGTCTCTGGCGTCCCAAATTGCCTGTTTTTCTC
HKR373748 RBd34G04 pGCAP10 NM_002482.2  
GAATCTGCCATTTTCTGTCCCTGAGTGAGTCTCTGGCGTCCCAAATTGCCTGTTTTTCTC
HKR384077 RBd60D05 pGCAP10 NM_002482.2  
GAATCTGCCATTTTCTGTCCCTGAGTGAGTCTCTGGCGTCCCAAATTGCCTGTTTTTCTC
HKR390131 RBd75F11 pGCAP10 NM_002482.2  
GAATCTGCCATTTTCTGTCCCTGAGTGAGTCTCTGGCGTCCCAAATTGCCTGTTTTTCTC
HKR430053 RBdS075C05 pGCAP10 NM_002482.2  
GAATCTGCCATTTTCTGTCCCTGAGTGAGTCTCTGGCGTCCCAAATTGCCTGTTTTTCTC
HKR442222 RBdS105J06 pGCAP10 NM_002482.2  
GCTCTAATCTGCCATTTTCTGTCCCTGAGTGAGTCTCTGGCGTCCCAAATTGCCTGTTTT
HKR444206 RBdS110I14 pGCAP10 NM_002482.2  
GAATCTGCCATTTTCTGTCCCTGAGTGAGTCTCTGGCGTCCCAAATTGCCTGTTTTTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl