Prev. |  KEGG KO K01893 > 

RIKEN DNA Bank Human Resource - NARS1

Gene ID NCBI Gene 4677 |  KEGG hsa:4677
Gene Symbol NARS1
Protein Name asparaginyl-tRNA synthetase 1
Synonyms ASNRS|NARS
Ortholog resource in our bank

  NARS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081323 IRAL003F03 pOTB7 BC001687 NM_004539 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE085222 M01C013A22 pDONR221 FLJ04-B11 AK129897 NM_004539  
HGE085270 M01C013C22 pDONR221 FLJ04-B11 AK129897 NM_004539  
HGE085318 M01C013E22 pDONR221 FLJ04-B11 AK129897 NM_004539  
HGE085366 M01C013G22 pDONR221 FLJ04-B11 AK129897 NM_004539  
HGE085414 M01C013I22 pDONR221 FLJ04-B11 AK129897 NM_004539  
HGE085462 M01C013K22 pDONR221 FLJ04-B11 AK129897 NM_004539  
HGE085510 M01C013M22 pDONR221 FLJ04-B11 AK129897 NM_004539  
HGE085558 M01C013O22 pDONR221 FLJ04-B11 AK129897 NM_004539  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205421 ARiS013J05 pGCAP10 NM_004539.3  
GAAACCGCCGGTGCACGTTGGAGTCATAAGACGGCGTCGGTGTTGCAGTCTGTGTCCTTG
HKR372002 RBd30A02 pGCAP10 NM_004539.3  
GAGATCTACGCTCTCTGATGCAACGCCGGAATCGCGGAAACCGCCGGTGCACGTTGGAGT
HKR405221 RBdS013A21 pGCAP10 NM_004539.3  
TGGCCGGTGCACGTTGGAGTCATAAGACGGCGTCGGTGTTGCAGTCTGTGTCCTTGGAGG
HKR405367 RBdS013G23 pGCAP10 NM_004539.3  
TGGCCGGTGCACGTTGGAGTCATAAGACGGCGTCGGTGTTGCAGTCTGTGTCCTTGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl