Prev. |  KEGG KO K12887 > 

RIKEN DNA Bank Human Resource - HNRNPM

Gene ID NCBI Gene 4670 |  KEGG hsa:4670
Gene Symbol HNRNPM
Protein Name heterogeneous nuclear ribonucleoprotein M
Synonyms CEAR|HNRNPM4|HNRPM|HNRPM4|HTGR1|NAGR1|hnRNP M
Ortholog resources KEGG ortholog (KEGG orthology K12887) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011945 IRAK029O09 pCMV-SPORT6 BC019580 NM_031203 Full/var
HGY029770 IRAK074H02 pBluescriptR BC038753 NM_031203
HGY042542 IRAK106F22 pBluescript BC045573 NM_031203
HGX047906 IRAK119M18 pCMV-SPORT6 BC058893 NM_031203 Full/var
HGX055839 IRAK139J23 pCMV-SPORT6 BC064588 NM_031203 Partial/var
HGY085895 IRAL014M07 pOTB7 BC008895 NM_031203 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050107 ARe25E11 pKA1U5 NM_005968.3  
TGTAAAAAGCCCAGACGCGGAGAAAATGGCGGCAGGGGTCGAAGCGGCGGCGGAGGTGGC
HKR169750 ARi24G06 pGCAP10 NM_005968.3  
GAAAGCCCAGACGCGGAGAAAATGGCGGCAGGGGTCGAAGCGGCGGCGGAGGTGGCGGCG
HKR222264 ARiS055K24 pGCAP10 NM_005968.3  
GAGACGCGGAGAAAATGGCGGCAGGGGTCGAAGCGGCGGCGGAGGTGGCGGCGACGGAGA
HKR370429 RBd26B05 pGCAP10 NM_005968.3  
GGCTCACACAAAGCCCAGACGCGGAGAAAATGGCGGCAGGGGTCGAAGCGGCGGCGGAGG
HKR402848 RBdS007B24 pGCAP10 NM_005968.3  
GAGACGCGGAGAAAATGGCGGCAGGGGTCGAAGCGGCGGCGGAGGTGGCGGCGACGGAGA
HKR406363 RBdS015P03 pGCAP10 NM_005968.3  
GAGACGCGGAGAAAATGGCGGCAGGGGTCGAAGCGGCGGCGGAGGTGGCGGCGACGGANA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl