Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NACA

Gene ID (NCBI) 4666
Gene Symbol NACA
Protein Name nascent polypeptide-associated complex alpha subunit
Synonyms HSD48|NAC-alpha|NACA1|skNAC
Databases KEGG hsa:4666 |  NCBI Gene 4666
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03626)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04464 SEREX clone BRC-Co-10 #1 SEREX clone BRC-Co-10 #1

RDB_org_170226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050004 ARe25A04 pKA1U5 NM_005594.4  
GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
HKR050973 ARe27H05 pKA1U5 NM_005594.4  
GGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCG
HKR055207 ARe38A07 pKA1U5 NM_005594.4  
GCTTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAG
HKR058051 ARe45C03 pKA1U5 NM_005594.4  
ATCCTGGCTTTCTGCCGCCATCTTGGTTCCGCGCTTCNCTGCACAAAATGCCCGGCGAAG
HKR060058 ARe50C10 pKA1U5 NM_005594.4  
GCCCTGCACAGTAAGTACTTTCTGTGCCGCTACTGTCTATCCGCAGCCATCCGCCTTTCT
HKR060176 ARe50H08 pKA1U5 NM_005594.4  
GCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTT
HKR073348 ARe83G04 pKA1U5 NM_005594.4  
GCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTT
HKR076460 ARe91C12 pKA1U5 NM_005594.4  
GCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTTC
HKR077253 ARe93C05 pKA1U5 NM_005594.4  
GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
HKR166975 ARi17H07 pGCAP10 NM_005594.4  
GCCCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCT
HKR170955 ARi27G11 pGCAP10 NM_005594.4  
GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
HKR173308 ARi33E12 pGCAP10 NM_005594.4  
GCCCTGCACAGTAAGTACTTTCTGTGCCGCTACTGTCTATCCGCAGCCATCCGCCTTTCT
HKR174953 ARi37G09 pGCAP10 NM_005594.4  
GGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCAC
HKR179352 ARi48G08 pGCAP10 NM_005594.4  
TGGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCC
HKR184457 ARi61C09 pGCAP10 NM_005594.4  
GCTTTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACA
HKR185376 ARi63H08 pGCAP10 NM_005594.4  
GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAGCCTCCTTTTTATTCCCTTCCT
HKR203283 ARiS008D11 pGCAP10 NM_005594.4  
GCTTTCTGCCGCCNTCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
HKR203358 ARiS008G14 pGCAP10 NM_005594.4  
GCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCC
HKR203396 ARiS008I04 pGCAP10 NM_005594.4  
GAGCCATCCGCCTTTCTTTCGGGCTAAGCCGCCCCGGGGACTGAGAGTTAAGGAGAGTTG
HKR209336 ARiS023F16 pGCAP10 NM_005594.4  
GCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTT
HKR222307 ARiS055M19 pGCAP10 NM_005594.4  
GCTTTTTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCA
HKR264540 ARiS161F20 pGCAP10 NM_005594.4  
CGGCCGGCCGATGCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCT
HKR276748 ARiS191O12 pGCAP10 NM_005594.4  
GGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCC
HKR277657 ARiS194C09 pGCAP10 NM_005594.4  
GCCCCTCCNCTCCANGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTT
HKR326145 RBb15G01 pKA1U5 NM_005594.4  
GGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCC
HKR328476 RBb21D04 pKA1U5 NM_005594.4  
GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
HKR333659 RBb34C11 pGCAP1 NM_005594.4  
GGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCC
HKR334883 RBb37D11 pGCAP1 NM_005594.4  
GCCATCTTGGTTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGTAAACCGGTC
HKR340034 RBb50B10 pGCAP1 NM_005594.4  
GGCCATCTTGGTTCCGCGGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCC
HKR343329 RBb58F09 pGCAP1 NM_005594.4  
GCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTCC
HKR368473 RBd21D01 pGCAP10 NM_005594.4  
GATCCGCAGCCATCCGCCTTTCTTTCGGGCTAAGCCGCCCCGGGGACTGAGAGTTAAGGA
HKR372853 RBd32C05 pGCAP10 NM_005594.4  
GCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTC
HKR378002 RBd45A02 pGCAP10 NM_005594.4  
GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
HKR380025 RBd50B01 pGCAP10 NM_005594.4  
GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
HKR385235 RBd63B11 pGCAP10 NM_005594.4  
GGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCC
HKR398060 RBd95C12 pGCAP10 NM_005594.4  
GGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCAC
HKR398079 RBd95D07 pGCAP10 NM_005594.4  
GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
HKR405209 RBdS013A09 pGCAP10 NM_005594.4  
GCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACC
HKR409056 RBdS022K16 pGCAP10 NM_005594.4  
GATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCCTGC
HKR430267 RBdS075L03 pGCAP10 NM_005594.4  
GGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCG
HKR432714 RBdS081N02 pGCAP10 NM_005594.4  
CGGCCGGCCGATGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCC
HKR433540 RBdS083O04 pGCAP10 NM_005594.4  
GGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCAC
HKR471079 RBdS177L15 pGCAP10 NM_005594.4  
GGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCG
HKR474925 RBdS187F05 pGCAP10 NM_005594.4  
GCTTTCNNNCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl