DNA Bank Top |  KEGG KO K04402 > 

RIKEN DNA Bank Human Resource - GADD45B

Gene ID NCBI Gene 4616 |  KEGG hsa:4616
Gene Symbol GADD45B
Protein Name growth arrest and DNA damage inducible beta
Synonyms GADD45BETA|MYD118
Featured content NF-kappa B signaling pathway (human)
Featured content Apoptosis - human

Link

Ortholog resource in our bank

  GADD45B

External database

human GADD45B

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07529 pGL4-phGADD45B Promoter collection, Human GADD45B promoter    
RDB05377 pAxCALNLhGADD45B (reverse) Shuttle vector to generate rAd harboring human GADD45B (reverse)    
RDB05376 pAxCALNLhGADD45B (forward) Shuttle vector to generate rAd harboring human GADD45B (forward)    
RDB05029 pAxCALNLhGADD45B(reverse) Shuttle vector to generate rAd expressing human GADD45B    
RDB05028 pAxCALNLhGADD45B(forward) Shuttle vector to generate rAd expressing human GADD45B    
RDB04151 pAxCALNLhGADD45B (reverse) Shuttle vector to generate rAd harboring human GADD45B    
RDB03584 pAxCALNLhGADD45B (forward) Shuttle vector to generate rAd harboring human GADD45B (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE084028 M01C010B04 pDONR221 FLJ02-H02 AK129595 NM_015675  
HGE084076 M01C010D04 pDONR221 FLJ02-H02 AK129595 NM_015675  
HGE084124 M01C010F04 pDONR221 FLJ02-H02 AK129595 NM_015675  
HGE084172 M01C010H04 pDONR221 FLJ02-H02 AK129595 NM_015675  
HGE084220 M01C010J04 pDONR221 FLJ02-H02 AK129595 NM_015675  
HGE084268 M01C010L04 pDONR221 FLJ02-H02 AK129595 NM_015675  
HGE084316 M01C010N04 pDONR221 FLJ02-H02 AK129595 NM_015675  
HGE084364 M01C010P04 pDONR221 FLJ02-H02 AK129595 NM_015675  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055275 ARe38D03 pKA1U5 NM_015675.2  
GAGATCGCCGAAGCGTCGGACTACCGTTGGTTTCCGCAACATTCCTGGATTATCCTCGCC
HKR162531 ARi06F11 pGCAP10 NM_015675.2  
GAGATCGCCGAAGCGTCGGACTACCGTTGGTTTCCGCAACTTCCTGGATTATCCTCGCCA
HKR165275 ARi13D03 pGCAP10 NM_015675.2  
GAGATCGCCGAAGCGTCGGACTACCGTTGGTTTCCGCAACTTCCTGGATTATCCTCGCCA
HKR180057 ARi50C09 pGCAP10 NM_015675.2  
GAGATCGCCGAAGCGTCGGACTACCGTTGGTTTCCGCAACTTCCTGGATTATCCTCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl