Prev. |  KEGG KO K04729 > 

RIKEN DNA Bank Human Resource - MYD88

Gene ID NCBI Gene 4615 |  KEGG hsa:4615
Gene Symbol MYD88
Protein Name MYD88 innate immune signal transduction adaptor
Synonyms MYD88D
Ortholog resources KEGG ortholog (KEGG orthology K04729) in the DNA Bank
Featured content NF-kappa B signaling pathway (human)
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04654 pAxCALNLhMYD88(reverse) Shuttle vector to generate rAd expressing human MYD88
RDB04662 pAxCALNLhMYD88(forward) Shuttle vector to generate rAd expressing human MYD88

webcatalog20210331.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072007 ARe80A07 pKA1U5 NM_002468.4 done
GGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGCGCGGGGTC
HKR167308 ARi18E12 pGCAP10 NM_002468.4 done
GCCGCCATGGCTGCAGGAGGTCCCGGCGCGGGGTCTGCGGCCCCGGTCTCCTCCACATCC
HKR452956 RBdS132G12 pGCAP10 NM_002468.4 done
GGCAGGAGAAAGAGGAAGCGCTGGCAGACAATGCGACCCGACCGCGCTGAGGCTCCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl