Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MYD88

Gene ID (NCBI) 4615
Gene Symbol MYD88
Protein Name myeloid differentiation primary response 88
Synonyms MYD88D
Databases KEGG link 01 |  NCBI Gene link 01
Featured content NF-kappa B signaling pathway (human)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04654 pAxCALNLhMYD88(reverse) Shuttle vector to generate rAd expressing human MYD88
RDB04662 pAxCALNLhMYD88(forward) Shuttle vector to generate rAd expressing human MYD88

RDB_hum_161122.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167308 ARi18E12 pGCAP10 NM_002468.4 done
GCCGCCATGGCTGCAGGAGGTCCCGGCGCGGGGTCTGCGGCCCCGGTCTCCTCCACATCC
HKR072007 ARe80A07 pKA1U5 NM_002468.4 done
GGACCGCGCTGAGGCTCCAGGACCGCCCGCCATGGCTGCAGGAGGTCCCGGCGCGGGGTC
HKR452956 RBdS132G12 pGCAP10 NM_002468.4 done
GGCAGGAGAAAGAGGAAGCGCTGGCAGACAATGCGACCCGACCGCGCTGAGGCTCCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl