Prev. |  KEGG KO K09421 > 

RIKEN DNA Bank Human Resource - MYBL2

Gene ID NCBI Gene 4605 |  KEGG hsa:4605
Gene Symbol MYBL2
Protein Name MYB proto-oncogene like 2
Synonyms B-MYB|BMYB
Ortholog resource in our bank

  MYBL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046251 IRAK115K11 pCMV-SPORT6 BC053555 NM_002466 Full
HGY089038 IRAL022J22 pOTB7 BC007585 NM_002466 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022918 W01A057E22 pENTR-TOPO IRAK115K11 BC053555 NM_002466  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068452 ARe71C04 pKA1U5 NM_002466.2  
GAGATAGAAAAGTGCTTCAACCCGCGCCGGCGGCGACTGCAGTTCCTGCGAGCGAGGAGC
HKR370107 RBd25E11 pGCAP10 NM_002466.2  
TGGAGATAGAAAAGTGCTTCAACCCGCGCCGGCGGCGACTGCAGTTCCTGCGAGCGAGGA
HKR398929 RBd97F09 pGCAP10 NM_002466.2  
GTCCTGCGAGCGAGGAGCGCGGGACCTGCTGACACGCTGACGCCTTCGAGCGCGGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl