Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MUTYH

Gene ID (NCBI) 4595
Gene Symbol MUTYH
Protein Name mutY homolog
Synonyms CYP2C|MYH
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03575)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083972 IRAL009P12 pOTB7 BC003178 NM_012222 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE106009 M01C065A09 pDONR221 06_07-A05 BC003178 NM_012222  
HGE124431 M01C111B07 pDONR221 06-2_04-C04 BC003178 NM_012222  
HGE124479 M01C111D07 pDONR221 06-2_04-C04 BC003178 NM_012222  
HGE124527 M01C111F07 pDONR221 06-2_04-C04 BC003178 NM_012222  
HGE124575 M01C111H07 pDONR221 06-2_04-C04 BC003178 NM_012222  
HGE124623 M01C111J07 pDONR221 06-2_04-C04 BC003178 NM_012222  
HGE124671 M01C111L07 pDONR221 06-2_04-C04 BC003178 NM_012222  
HGE124719 M01C111N07 pDONR221 06-2_04-C04 BC003178 NM_012222  
HGE124767 M01C111P07 pDONR221 06-2_04-C04 BC003178 NM_012222  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR394802 RBd87A02 pGCAP10 NM_001048171.1  
GGAAGCTTGAGGAGCCTCTAGAACTATGAGCCCGAGGCCTTCCCCTCTCCCAGAGCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.05.31

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl