Prev. |  KEGG KO K01847 > 

RIKEN DNA Bank Human Resource - MMUT

Gene ID NCBI Gene 4594 |  KEGG hsa:4594
Gene Symbol MMUT
Protein Name methylmalonyl-CoA mutase
Synonyms MCM|MUT
Ortholog resource in our bank

  MMUT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006084 IRAK015D12 pCMV-SPORT6 BC016282 NM_000255 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041277 ARe03D05 pKA1U5 NM_000255.2  
GCTGGCTGTGTGGATGTCTGACAGGTGAGGCGGGGGACGCAGAAGTGCAGCCGCCCTCTC
HKR403134 RBdS007N22 pGCAP10 NM_000255.2  
GGTGGATGTCTGACAGGTGAGGCGGGGGACGCAGAAGTGCAGCCGCCCTCTCCCACAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl