Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDT1

Gene ID (NCBI) 4521
Gene Symbol NUDT1
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 1
Synonyms MTH1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX033635 IRAK084B11 pCMV-SPORT6 BC040144 NM_198953 Full/var
HGY084765 IRAL011P05 pOTB7 BC014618 NM_198954 Full
HGY099175 IRAL047P15 pOTB7 BC051375 NM_198953 Full
HGY100234 IRAL050J18 pOTB7 BC065367 NM_198954 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR205464 ARiS013K24 pGCAP10 NM_002452.3
GAGAGGCCACGCCCCCGGAAGCGGCGGTGCAGAACCCAGGGACCATGGGCGCCTCCAGGC
HKR336149 RBb40G05 pGCAP1 NM_002452.3
GGCCCCCGGAAGCGGCGGTGCAGAACCCAGGGACCATGGGCGCCTCCAGGCTCTATACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl