Prev. |  KEGG KO K17816 > 

RIKEN DNA Bank Human Resource - NUDT1

Gene ID NCBI Gene 4521 |  KEGG hsa:4521
Gene Symbol NUDT1
Protein Name nudix hydrolase 1
Synonyms MTH1
Ortholog resource in our bank

  NUDT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033635 IRAK084B11 pCMV-SPORT6 BC040144 NM_198953 Full/var
HGY084765 IRAL011P05 pOTB7 BC014618 NM_198954 Full
HGY099175 IRAL047P15 pOTB7 BC051375 NM_198953 Full
HGY100234 IRAL050J18 pOTB7 BC065367 NM_198954 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205464 ARiS013K24 pGCAP10 NM_002452.3  
GAGAGGCCACGCCCCCGGAAGCGGCGGTGCAGAACCCAGGGACCATGGGCGCCTCCAGGC
HKR336149 RBb40G05 pGCAP1 NM_002452.3  
GGCCCCCGGAAGCGGCGGTGCAGAACCCAGGGACCATGGGCGCCTCCAGGCTCTATACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl