Prev. |  KEGG KO K14739 > 

RIKEN DNA Bank Human Resource - MT1X

Gene ID NCBI Gene 4501 |  KEGG hsa:4501
Gene Symbol MT1X
Protein Name metallothionein 1X
Synonyms MT-1l|MT1
Ortholog resource in our bank

  MT1X

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008479 IRAK021D07 pCMV-SPORT6 BC018190 NM_005952 Full/var
HGX020730 IRAK051N18 pCMV-SPORT6 BC029916 NM_005952
HGX025762 IRAK064G18 pCMV-SPORT6 BC032338 NM_005952
HGX046186 IRAK115H18 pCMV-SPORT6 BC053882 NM_005952
HGY095627 IRAL039B03 pOTB7 BC032131 NM_005952 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092042 M01C030B18 pDONR221 MGC04-H09 BC018190 NM_005952  
HGE092090 M01C030D18 pDONR221 MGC04-H09 BC018190 NM_005952  
HGE092138 M01C030F18 pDONR221 MGC04-H09 BC018190 NM_005952  
HGE092186 M01C030H18 pDONR221 MGC04-H09 BC018190 NM_005952  
HGE092234 M01C030J18 pDONR221 MGC04-H09 BC018190 NM_005952  
HGE092282 M01C030L18 pDONR221 MGC04-H09 BC018190 NM_005952  
HGE092330 M01C030N18 pDONR221 MGC04-H09 BC018190 NM_005952  
HGE092378 M01C030P18 pDONR221 MGC04-H09 BC018190 NM_005952  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR071273 ARe78D01 pKA1U5 NM_005952.3  
ATCCTGACCACGCTTTTCATCTGTCCCGCTGCGTGTTTTCCTCTTGATCGGGAACTCCTG
HKR169370 ARi23H02 pGCAP10 NM_005952.3  
ACCACGCTTTTCATCTGTCCCGCTGCGTGTTTTCCTCTTGATCGGGAACTCCTGCTTCTC
HKR180805 ARi52A05 pGCAP10 NM_005952.3  
GACCACGCTTTTCATCTGTCCCGCTGCGTGTTTTCCTCTTGATCGGGAACTCCTGCTTCT
HKR395677 RBd89D05 pGCAP10 NM_005952.3  
GACCACGCTTTTCATCTGTCCCGCTGCGTGTTTTCCTCTTGATCGGGAACTCCTGCTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl