Prev. |  KEGG KO K14739 > 

RIKEN DNA Bank Human Resource - MT1M

Gene ID NCBI Gene 4499 |  KEGG hsa:4499
Gene Symbol MT1M
Protein Name metallothionein 1M
Synonyms MT-1M|MT-IM|MT1|MT1K
Ortholog resource in our bank

  MT1M

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025763 IRAK064G19 pCMV-SPORT6 BC028280 NM_176870 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE088418 M01C021A18 pDONR221 IMS03-B09 BC028280 NM_176870  
HGE088466 M01C021C18 pDONR221 IMS03-B09 BC028280 NM_176870  
HGE088514 M01C021E18 pDONR221 IMS03-B09 BC028280 NM_176870  
HGE088562 M01C021G18 pDONR221 IMS03-B09 BC028280 NM_176870  
HGE088610 M01C021I18 pDONR221 IMS03-B09 BC028280 NM_176870  
HGE088658 M01C021K18 pDONR221 IMS03-B09 BC028280 NM_176870  
HGE088706 M01C021M18 pDONR221 IMS03-B09 BC028280 NM_176870  
HGE088754 M01C021O18 pDONR221 IMS03-B09 BC028280 NM_176870  
HGE093630 M01C034B06 pDONR221 MGC06-H03 BC028280 NM_176870  
HGE093678 M01C034D06 pDONR221 MGC06-H03 BC028280 NM_176870  
HGE093726 M01C034F06 pDONR221 MGC06-H03 BC028280 NM_176870  
HGE093774 M01C034H06 pDONR221 MGC06-H03 BC028280 NM_176870  
HGE093822 M01C034J06 pDONR221 MGC06-H03 BC028280 NM_176870  
HGE093870 M01C034L06 pDONR221 MGC06-H03 BC028280 NM_176870  
HGE093918 M01C034N06 pDONR221 MGC06-H03 BC028280 NM_176870  
HGE093966 M01C034P06 pDONR221 MGC06-H03 BC028280 NM_176870  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047226 ARe18B02 pKA1U5 NM_176870.2  
GAGCCCAGCCCAGGACCGCTGGCGGTGCGAACCCAGCCGGGCGGGTGCAAGCGCGGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl