Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MSH2

Gene ID (NCBI) 4436
Gene Symbol MSH2
Protein Name mutS homolog 2
Synonyms COCA1|FCC1|HNPCC|HNPCC1|LCFS2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08735)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY096052 IRAL040C04 pOTB7 BC021566 NM_000251 Full
HGY081302 IRAL003E06 pOTB7 BC001122 NM_000251 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366927 RBd17F07 pGCAP10 NM_000251.1  
GGAGGCGGGAAACAGCTTAGTGGGTGTGGGGTCGCGCATTTTCTTCAACCAGGAGGTGAG
HKR386108 RBd65E12 pGCAP10 NM_000251.1  
GGAAAACAGCTTAGTGGGTGTGGGGTCGCGCATTTTCTTCAACCAGGAGGTGAGGAGGTT
HKR388107 RBd70E11 pGCAP10 NM_000251.1  
GAACCAGGAGGTGAGGAGGTTTCGACATGGCGGTGCAGCCGAAGGAGACGCTGCAGTTGG
HKR399207 RBd98A07 pGCAP10 NM_000251.1  
GGGGTCGCGCATTTTCTTCAACCAGGAGGTGAGGAGGTTTCGACATGGCGGTGCAGCCGA
HKR399377 RBd98H09 pGCAP10 NM_000251.1  
TGGGTCCCTCATTTTCGTCACCCCCCCGATGAGCAGGTCTCGACTNNGCCGATCCGCCGC
HKR441855 RBdS104K15 pGCAP10 NM_000251.1  
CGGCCGGCCGATGAGGAGGTGAGGAGGTTTCGACATGGCGGTGCAGCCGAAGGAGACGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl