Prev. |  KEGG KO K13348 > 

RIKEN DNA Bank Human Resource - MPV17

Gene ID NCBI Gene 4358 |  KEGG hsa:4358
Gene Symbol MPV17
Protein Name mitochondrial inner membrane protein MPV17
Synonyms CMT2EE|MTDPS6|SYM1
Ortholog resource in our bank

  MPV17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006248 IRAK015K08 pCMV-SPORT6 BC016289 NM_002437 Partial
HGY081411 IRAL003I19 pOTB7 BC001115 NM_002437 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004232 W01A010J16 pENTR-TOPO IRAL003I19 BC001115 NM_002437  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058173 ARe45H05 pKA1U5 NM_002437.4  
GAGGGAGGCTCGGCGCTCAGGAAGCATGGCACTCTGGCGGGCATACCAGCGGGCCCTGGC
HKR166102 ARi15E06 pGCAP10 NM_002437.4  
GAGGCTCGGCGCTCAGGAAGCATGGCACTCTGGCGGGCATACCAGCGGGCCCTGGCCGCT
HKR166150 ARi15G06 pGCAP10 NM_002437.4  
GAGGCTCGAGCGCTCAGGAAGCATGGNCTCTGGAGGGCANNNNNNGGGCCCTGGCCGCTC
HKR361225 RBd03B01 pGCAP10 NM_002437.4  
GGGAGGGAGGCTCGGCGCTCAGGAAGCATGGCACTCTGGCGGGCATACCAGCGGGCCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl