Prev. |  KEGG KO K01809 > 

RIKEN DNA Bank Human Resource - MPI

Gene ID NCBI Gene 4351 |  KEGG hsa:4351
Gene Symbol MPI
Protein Name mannose phosphate isomerase
Synonyms CDG1B|PMI|PMI1
Ortholog resource in our bank

  MPI

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035766 IRAK089G22 pCMV-SPORT6 BC046357 NM_002435 Full
HGY095881 IRAL039L17 pOTB7 BC017351 NM_002435 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094847 M01C037B23 pDONR221 MGC08-C12 BC046357 NM_002435  
HGE094895 M01C037D23 pDONR221 MGC08-C12 BC046357 NM_002435  
HGE094943 M01C037F23 pDONR221 MGC08-C12 BC046357 NM_002435  
HGE094991 M01C037H23 pDONR221 MGC08-C12 BC046357 NM_002435  
HGE095039 M01C037J23 pDONR221 MGC08-C12 BC046357 NM_002435  
HGE095087 M01C037L23 pDONR221 MGC08-C12 BC046357 NM_002435  
HGE095135 M01C037N23 pDONR221 MGC08-C12 BC046357 NM_002435  
HGE095183 M01C037P23 pDONR221 MGC08-C12 BC046357 NM_002435  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072129 ARe80F09 pKA1U5 NM_002435.1  
GAGGGGGCGAGCATGGCCGCTCCGCGAGTATTCCCACTTTCCTGTGCGGTGCAGCAGTAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl