Prev. |  KEGG KO K03652 > 

RIKEN DNA Bank Human Resource - MPG

Gene ID NCBI Gene 4350 |  KEGG hsa:4350
Gene Symbol MPG
Protein Name N-methylpurine DNA glycosylase
Synonyms AAG|ADPG|APNG|CRA36.1|MDG|Mid1|PIG11|PIG16|anpg
Ortholog resources KEGG ortholog (KEGG orthology K03652) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY093963 IRAL034P03 pOTB7 BC014991 NM_001015054 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024584 W01A061H16 pENTR-TOPO IRAL034P03 BC014991 NM_001015054  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063728 ARe59F08 pKA1U5 NM_002434.2  
GGTGCTTCCGTGGTCGGCGGCTGCTGGGCTCCGCGCCGGGGTCCGAGTCCCACGAAGCCC
HKR168879 ARi22D07 pGCAP10 NM_002434.2  
GGGGGTCCGAGTCCCACGAAGCCCCGGCCCGAGCCGCCGGATGCCCGCGCGCAGCGGGGC
HKR243703 ARiS109E07 pGCAP10 NM_002434.2  
GGGTCCTANGGGTGCTTCCGTGGTCGGCGGCTGCTGGGCTCCGCGCCGGGGTCCGAGTCC
HKR363683 RBd09D11 pGCAP10 NM_002434.2  
ACGAAGCCCCGGCCCGAGCCGCCGGATGCCCGCGCGCAGCGGGGCCCAGTTTTGCCGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl