Prev. |  KEGG KO K06556 > 

RIKEN DNA Bank Human Resource - CD200

Gene ID NCBI Gene 4345 |  KEGG hsa:4345
Gene Symbol CD200
Protein Name CD200 molecule
Synonyms MOX1|MOX2|MRC|OX-2
Ortholog resources KEGG ortholog (KEGG orthology K06556) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY012868 IRAK032C20 pBluescriptR BC022522 NM_005944 Full/var
HGY019548 IRAK048O12 pBluescriptR BC031103 NM_005944 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR121756 ARh04G12 pGCAP1 NM_005944.5  
GAGTCAGCCACCTCGCGCGCGCCTCCAGGAGCAAGGATGGAGAGGCTGGTGATCAGGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl