Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MNAT1

Gene ID (NCBI) 4331
Gene Symbol MNAT1
Protein Name MNAT CDK-activating kinase assembly factor 1
Synonyms CAP35|MAT1|RNF66|TFB3
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001959 IRAK004O23 pCMV-SPORT6 BC000820 NM_002431 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE001361 W01A003G17 pENTR-TOPO IRAK004O23 BC000820 NM_002431
HGE001363 W01A003G19 pENTR-TOPO IRAK004O23 BC000820 NM_002431
HGE001365 W01A003G21 pENTR-TOPO IRAK004O23 BC000820 NM_002431

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR060083 ARe50D11 pKA1U5 NM_002431.2
GGTTGGTAGGAACCTGCTTGGTCGCGTCTGAGGGGGCTTGTAGGTGGCTCTGGCTGAAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.02

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl