Prev. |  KEGG KO K00140 > 

RIKEN DNA Bank Human Resource - ALDH6A1

Gene ID NCBI Gene 4329 |  KEGG hsa:4329
Gene Symbol ALDH6A1
Protein Name aldehyde dehydrogenase 6 family member A1
Synonyms MMSADHA|MMSDH
Ortholog resources KEGG ortholog (KEGG orthology K00140) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025675 IRAK064D03 pCMV-SPORT6 BC032371 NM_005589 Full
HGY084613 IRAL011I21 pOTB7 BC004909 NM_005589 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR371230 RBd28B06 pGCAP10 NM_005589.2  
GAGAGGCGCGGGGTGCGGAGCTAGGGCGGCCGAGAGCCATGGCGGCGCTATTGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl