Prev. |  KEGG KO K01398 > 

RIKEN DNA Bank Human Resource - MMP2

Gene ID NCBI Gene 4313 |  KEGG hsa:4313
Gene Symbol MMP2
Protein Name matrix metallopeptidase 2
Synonyms CLG4|CLG4A|MMP-2|MMP-II|MONA|TBE-1
Ortholog resource in our bank

  MMP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05479 pKM2L-phCLG4 Promoter Bank clone, Human collagenase type IV (CLG4/MMP-2) promoter
RDB05828 pAxit-phCLG4-rLuc (F) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB07314 pGL4-phMMP2 Promoter collection, Human MMP2 promoter
RDB19846 pJNC-hMMP2-GLuc Mammalian expression vector of human matrix metalloprotease-2 (hMMP2) and G. princeps Gaussia luciferase (GLuc).

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081648 IRAL004B24 pOTB7 BC002576 NM_004530 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024Jan15.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046900 ARe17E04 pKA1U5 NM_004530.4  
GGCGGCGGCGGCGGCNGCGGCGGGGGCTGGGGCGCGGGGGCCGGACCATGAGCCGCTGAG
HKR058176 ARe45H08 pKA1U5 NM_004530.4  
GGCCAGGACCTGCGGCGGCGGCGGCGGCGGCGNGTTTCTGGGGCGCGGGGGCCGGACCAT
HKR172835 ARi32B11 pGCAP10 NM_004530.4  
GGGCGGCGGGGGCTGGGGCGCGGGGGCCGGACCATGAGCCGCTGAGCCGGGCAAACCCCA
HKR219691 ARiS049D19 pGCAP10 NM_004530.4  
GACCCTCGGAGCGCANCCCTGCGCCGCGGAGCAGGCTCCAACCAGGCGGCGACGCGGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2024.02.05

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl