Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATXN3

Gene ID (NCBI) 4287
Gene Symbol ATXN3
Protein Name ataxin 3
Synonyms AT3|ATX3|JOS|MJD|MJD1|RP11-529H20.5|SCA3
Databases KEGG link 01 |  NCBI Gene link 01


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01783 pMJD1-1 Human MJD1 cDNA
RDB01784 pMJD2-1 Human MJD1 cDNA
RDB02298 pAxCAhMJD1-1 (forward) Shuttle vector to produce rAd expressing human MJD1-1
RDB02299 pAxCAhMJD1-1 (reverse) Shuttle vector to produce rAd expressing human MJD1-1
RDB02322 pAxCAhMJD1-2 (forward) Shuttle vector to produce rAd expressing human MJD1-2
RDB02323 pAxCAhMJD1-2 (reverse) Shuttle vector to produce rAd expressing human MJD1-2
RDB02751 AxCAhMJD1-2 (forward) Recombinant adenovirus harboring human MJD1 cDNA

RDB_hum_160722.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027298 IRAK068E02 pCMV-SPORT6 BC033711 NM_001024631 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE009385 W01A023H17 pENTR-TOPO IRAK068E02 BC033711 NM_001024631
HGE009389 W01A023H21 pENTR-TOPO IRAK068E02 BC033711 NM_001024631

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR382451 RBd56C03 pGCAP10 NM_004993.4
GGTGGGGGCCGTTGGCTCCAGACAAATAAACATGGAGTCCATCTTCCACGAGAAACAAGA
HKR390925 RBd77F05 pGCAP10 NM_004993.4
GGTGGGGGCCGTTGGCTCCAGACAAATAAACATGGAGTCCATCTTCCACGAGAAACAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl