Prev. |  KEGG KO K01410 > 

RIKEN DNA Bank Human Resource - MIPEP

Gene ID NCBI Gene 4285 |  KEGG hsa:4285
Gene Symbol MIPEP
Protein Name mitochondrial intermediate peptidase
Synonyms COXPD31|HMIP|MIP
Ortholog resource in our bank

  MIPEP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086286 IRAL015L22 pOTB7 BC009934 NM_005932 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098438 M01C046B14 pDONR221 MGC12-H07 BC009934 ENST00000382172  
HGE098486 M01C046D14 pDONR221 MGC12-H07 BC009934 ENST00000382172  
HGE098534 M01C046F14 pDONR221 MGC12-H07 BC009934 ENST00000382172  
HGE098582 M01C046H14 pDONR221 MGC12-H07 BC009934 ENST00000382172  
HGE098630 M01C046J14 pDONR221 MGC12-H07 BC009934 ENST00000382172  
HGE098678 M01C046L14 pDONR221 MGC12-H07 BC009934 ENST00000382172  
HGE098726 M01C046N14 pDONR221 MGC12-H07 BC009934 ENST00000382172  
HGE098774 M01C046P14 pDONR221 MGC12-H07 BC009934 ENST00000382172  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172102 ARi30E06 pGCAP10 NM_005932.2  
GGAAAGCAGCAGGGCAGGGATCTGCGTTGGAGGAAGGGACTGCTCTGGTGCTAGAATGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl