Prev. |  KEGG KO K06520 > 

RIKEN DNA Bank Human Resource - CD99

Gene ID NCBI Gene 4267 |  KEGG hsa:4267
Gene Symbol CD99
Protein Name CD99 molecule (Xg blood group)
Synonyms HBA71|MIC2|MIC2X|MIC2Y|MSK5X
Ortholog resources KEGG ortholog (KEGG orthology K06520) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081696 IRAL004D24 pOTB7 BC002584 NM_002414 Full
HGY083680 IRAL009D08 pOTB7 BC003147 NM_002414 Full
HGY083688 IRAL009D16 pOTB7 BC021620 NM_002414 Full
HGY088713 IRAL021N01 pDNR-LIB BC024310 NM_002414 Full
HGY090920 IRAL027E24 pOTB7 BC010109 NM_002414

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055374 ARe38H06 pKA1U5 NM_002414.3  
GGGGACCGTCCCTGCGCGCTCTGGGCGCACCACNGGTCCGCGGGGCTGCGCTGGCGCTGC
HKR056570 ARe41H02 pKA1U5 NM_002414.3  
GACTCCGGGACCGTTCCCTGCGCGCTCTGGGCGCACCATGGCCCGCGGGGCTGCGCTGGC
HKR064807 ARe62A07 pKA1U5 NM_002414.3  
GGTATCTGTCCTGCCGCCTTCGCCCACGCCCTGCACTCCGGGACCGTCCCTGCGCGCTCT
HKR071351 ARe78G07 pKA1U5 NM_002414.3  
GGTCCCTGCGCGCTCTGGGCGCACCATGGCCCGCGGGGCTGCGCTGGCGCTGCTGCTCTT
HKR168549 ARi21G05 pGCAP10 NM_002414.3  
GGCGGGCGCAGCCGGCGCTGAGCTTGCAGGGCCGCTCCCCTCACCCGCCCCCTTCGAGTC
HKR168553 ARi21G09 pGCAP10 NM_002414.3  
GGCGGGCGCAGCCGGCGCTGAGCTTGCAGGGCCGCTCCCCTCACCCGCCCCCTTCGAGTC
HKR172898 ARi32E02 pGCAP10 NM_002414.3  
GACTCCGGGACCGTCCCTGCGCGCTCTGGGCGCACCATGGCCCGCGGGGCTGCGCTGGCG
HKR173348 ARi33G04 pGCAP10 NM_002414.3  
GGCTGAGCTTGCAGGGCCGCTCCCCTCACCCGCCCCCTTCGAGTCCCCGGGCTTCGCCCC
HKR234204 ARiS085I12 pGCAP10 NM_002414.3  
GATCTGTCCTGCCGCCTTCGCCCACGCCCTGCACTCCGGGACCGTCCCTGCGCGCTCTGG
HKR238703 ARiS096M15 pGCAP10 NM_002414.3  
GCCGGCCCGTGGGGGAGTATCTGTCCTGCCGCCTTCGCCCACGCCCTGCACTCCGGGACC
HKR238704 ARiS096M16 pGCAP10 NM_002414.3  
GACCCGCCCCCTTCGAGTCCCCGGGCTTCNCCCCACCCGGCCCGTGGGGGAGTATCTGTC
HKR249122 ARiS122N10 pGCAP10 NM_002414.3  
GAGCCGGCGCTGAGCTTGCAGGGCCGCTCCCCTCACCCGCCCCCTTCGAGTCCCCGGGCT
HKR403041 RBdS007K01 pGCAP10 NM_002414.3  
GACCCGCCCCCTTCGAGTCCCCGGGCTTCGCCCCACCCGGCCCGTGGGGGAGTATCTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl