Prev. |  KEGG KO K00799 > 

RIKEN DNA Bank Human Resource - MGST3

Gene ID NCBI Gene 4259 |  KEGG hsa:4259
Gene Symbol MGST3
Protein Name microsomal glutathione S-transferase 3
Synonyms GST-III
Ortholog resource in our bank

  MGST3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080570 IRAL001H02 pOTB7 BC000505 NM_004528 Full
HGY083781 IRAL009H13 pOTB7 BC003034 NM_004528 Full
HGY088653 IRAL021K13 pDNR-LIB BC005964 NM_004528 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004296 W01A010M08 pENTR-TOPO IRAL021K13 BC005964 NM_004528  
HGE004310 W01A010M22 pENTR-TOPO IRAL009H13 BC003034 NM_004528  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165609 ARi14A09 pGCAP10 NM_004528.2  
GGTTCGAAGGTGATCCAGACGCAAGATGGCTGTCCTCTCTAAGGAATATGGTTTTGTGCT
HKR174012 ARi35A12 pGCAP10 NM_004528.2  
GGCAGTTTTGTTCTGCTCCAGCTGTTCGAAGGTGATCCAGACGCAAGATGGCTGTCCTCT
HKR177380 ARi43H12 pGCAP10 NM_004528.2  
GGTTCTGCTCCAGCTGTTCGAAGGTGATCCAGACGCAAGATGGCTGTCCTCTCTAAGGAA
HKR203311 ARiS008E15 pGCAP10 NM_004528.2  
GAGGCGAGGGCGCCGCACCCACACCGCGCTGCGCAGTTTTGTTCTGCTCCAGCTGTTCGA
HKR208121 ARiS020F01 pGCAP10 NM_004528.2  
GGAGGGCGCCGCACCCACACCGCGCTGCGCAGTTTTGTTCTGCTCCAGCTGTTCGAAGGT
HKR222167 ARiS055G23 pGCAP10 NM_004528.2  
GACCCACACCGCGCTGCGCAGTTTTGTTCTGCTCCAGCTGTTCGAAGGTGATCCAGACGC
HKR276423 ARiS191A23 pGCAP10 NM_004528.2  
GGTTCTGCTCCAGCTGTTCGAAGGTGATCCAGACGCAAGATGGCTGTCCTCTCTAAGGAA
HKR321203 RBb03A03 pKA1U5 NM_004528.2  
GGAGGGCGCCGCACCCACACCGCGCTGCGCAGTTTTGTTCTGCTCCAGCTGTTCGAAGGT
HKR344507 RBb61E11 pGCAP1 NM_004528.2  
GGAGGGCGCCGCACCCACACCGCGCTGCGCAGTTTTGTTCTGCTCCAGCTGTTCGAAGGT
HKR406250 RBdS015K10 pGCAP10 NM_004528.2  
TGGGTTCTGCTCCAGCTGTTCGAAGGTGATCCAGACGCAAGATGGCTGTCCTCTCTAAGG
HKR432729 RBdS081N17 pGCAP10 NM_004528.2  
ATCTAGCCCCGCCCCAGGCGAGGGCGCCGCACCCACACCGCGCTGCGCAGTTTTGTTCTG
HKR462479 RBdS156D07 pGCAP10 NM_004528.2  
GGCCGCACCCACACCGCGCTGCGCAGTTTTGTTCTGCTCCAGCTGTTCGAAGGTGATCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl