Prev. |  KEGG KO K00799 > 

RIKEN DNA Bank Human Resource - MGST1

Gene ID NCBI Gene 4257 |  KEGG hsa:4257
Gene Symbol MGST1
Protein Name microsomal glutathione S-transferase 1
Synonyms GST12|MGST|MGST-I
Ortholog resource in our bank

  MGST1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088542 IRAL021F22 pDNR-LIB BC005923 NM_145792 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR054881 ARe37D09 pKA1U5 NM_145792.1  
GATTGCGCGCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGGCCTCACCAT
HKR065229 ARe63B05 pKA1U5 NM_145792.1  
GGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGGCCTCACCATTCCAGACCAAAATTGAA
HKR068429 ARe71B05 pKA1U5 NM_145792.1  
GGCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGGCCTCACCATTCCAGAC
HKR167356 ARi18G12 pGCAP10 NM_145792.1  
GATTGCGCGCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGGCCTCACCAT
HKR172402 ARi31A02 pGCAP10 NM_145792.1  
GATTGCGCGCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGGCCTCACCAT
HKR176802 ARi42A02 pGCAP10 NM_145792.1  
GGCTGCTTCCTCCTCCTCGGCCTCACCATTCCAGACCAAAATTGAAAAAATGGTTGACCT
HKR180812 ARi52A12 pGCAP10 NM_145792.1  
GAGTCCCTGCATTGCGCGCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGG
HKR183603 ARi59A03 pGCAP10 NM_145792.1  
GCATTGCGCGCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGGCCTCACCA
HKR183630 ARi59B06 pGCAP10 NM_145792.1  
GGCTGCTTCCTCCTCCTCGGCCTCACCATTCCAGACCAAAATTGAAAAAATGGTTGACCT
HKR222338 ARiS055O02 pGCAP10 NM_145792.1  
GGCATTGCGCGCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGGCCTCACC
HKR260239 ARiS150J23 pGCAP10 NM_145792.1  
GAGTCCCTGCATTGCNCNCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGG
HKR399203 RBd98A03 pGCAP10 NM_145792.1  
GGAGGCTTGCTGCTGCCCCCTCCTCGGCCTCACGATTCCGGACCANNATGGAAAAAATGG
HKR399228 RBd98B04 pGCAP10 NM_145792.1  
GAGGCTTGCTGCTTCCTCCTCCTCGGCCTCACCATTCCAGACCAAAATTGAAAAAATGGT
HKR430241 RBdS075K01 pGCAP10 NM_145792.1  
GAGTCCCTGCATTGCGCGCGACCCGGCGGCGGGACAGGCTTGCTGCTTCCTCCTCCTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl